Rab3il1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rab3il1em1(IMPC)J |
Name: |
RAB3A interacting protein (rabin3)-like 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7367264 |
Gene: |
Rab3il1 Location: Chr19:9979033-10015744 bp, + strand Genetic Position: Chr19, 6.26 cM
|
Alliance: |
Rab3il1em1(IMPC)J page
|
IMPC: |
Rab3il1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGACATTAACCCCATGTTG and TCATATCCCAGTCCCCCCCA, which resulted in a 2304 bp deletion beginning at Chromosome 19 position 10,028,253 bp and ending after 10,030,556 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000144232, ENSMUSE00000144233, and ENSMUSE00000144237 (exons 5,6, and 7) and 1843 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 20 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|