Fitm1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Fitm1em1(IMPC)J |
| Name: |
fat storage-inducing transmembrane protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7367236 |
| Gene: |
Fitm1 Location: Chr14:55813131-55814409 bp, + strand Genetic Position: Chr14, 28.19 cM
|
| Alliance: |
Fitm1em1(IMPC)J page
|
| IMPC: |
Fitm1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAGGACTGACGGTCAACA and GTACGTGACTTCCATCCTGT, which resulted in a 1578 bp deletion beginning at Chromosome 14 position 55,575,498 bp and ending after 55,577,075 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124452 and ENSMUSE00000317360 (exons 1 and 2) and 607 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|