About   Help   FAQ
Fitm1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fitm1em1(IMPC)J
Name: fat storage-inducing transmembrane protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7367236
Gene: Fitm1  Location: Chr14:55813131-55814409 bp, + strand  Genetic Position: Chr14, 28.19 cM
Alliance: Fitm1em1(IMPC)J page
IMPC: Fitm1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAGGACTGACGGTCAACA and GTACGTGACTTCCATCCTGT, which resulted in a 1578 bp deletion beginning at Chromosome 14 position 55,575,498 bp and ending after 55,577,075 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124452 and ENSMUSE00000317360 (exons 1 and 2) and 607 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fitm1 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory