About   Help   FAQ
Del(4Nppb-Nppa)4Vmc
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(4Nppb-Nppa)4Vmc
Name: deletion, Chr4, Vincent M Christoffels 4
MGI ID: MGI:7366921
Synonyms: Nppa-Nppb-, Nppa-Nppb dKO
Gene: Del(4Nppb-Nppa)4Vmc  Location: unknown  Genetic Position: Chr4, Syntenic
Mutation
origin
Strain of Origin:  FVB/NRj
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Null/knockout)
Mutations:    Intergenic deletion, Intragenic deletion
  Del(4Nppb-Nppa)4Vmc involves 5 genes/genome features (Nppb, Rr604544, Nppa ...) View all
 
Mutation detailsThe Nppa and Nppb genes were targeted with sgRNAs (targeting GACTACATGGCAGATCACCC and GGCCAGTTCAAACGATTTGT) using CRISPR/Cas9 technology, resulting in the deletion of both genes and enhancers Rr604544 and Rr604547 in-between, as well as the 3' end of the Gm13054 lncRNA gene. (J:309962)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(4Nppb-Nppa)4Vmc Mutation:  0 strains or lines available
References
Original:  J:309962 Man JCK, et al., Genetic Dissection of a Super Enhancer Controlling the Nppa-Nppb Cluster in the Heart. Circ Res. 2021 Jan 8;128(1):115-129
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory