Nppb^em1Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nppb^em1Vmc
• Name: natriuretic peptide type B; endonuclease-mediated mutation 1, Vincent M Christoffels
• MGI ID: MGI:7366919
• Synonyms: RE2^-
• Gene: Nppb Location: Chr4:148070264-148071662 bp, + strand Genetic Position: Chr4, 78.57 cM
• Alliance: Nppb^em1Vmc page

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The potential Nppa/Nppb regulatory region upstream of Nppb was targeted with sgRNAs (targeting GGTTAATTGATTAAAAGTGG and GGGAATGCCTCAGCTACTGT) using CRISPR/Cas9 technology, resulting in the deletion of enhancer Rr93033 and the Nppb gene. (J:309962)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nppb Mutation: 14 strains or lines available

References

• Original: J:309962 Man JCK, et al., Genetic Dissection of a Super Enhancer Controlling the Nppa-Nppb Cluster in the Heart. Circ Res. 2021 Jan 8;128(1):115-129
• All: 1 reference(s)