About   Help   FAQ
Nppbem1Vmc
Endonuclease-mediated Allele Detail
Summary
Symbol: Nppbem1Vmc
Name: natriuretic peptide type B; endonuclease-mediated mutation 1, Vincent M Christoffels
MGI ID: MGI:7366919
Synonyms: RE2-
Gene: Nppb  Location: Chr4:148070264-148071662 bp, + strand  Genetic Position: Chr4, 78.57 cM
Alliance: Nppbem1Vmc page
Mutation
origin
Strain of Origin:  FVB/NRj
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Null/knockout)
Mutations:    Intergenic deletion, Intragenic deletion
 
Mutation detailsThe potential Nppa/Nppb regulatory region upstream of Nppb was targeted with sgRNAs (targeting GGTTAATTGATTAAAAGTGG and GGGAATGCCTCAGCTACTGT) using CRISPR/Cas9 technology, resulting in the deletion of enhancer Rr93033 and the Nppb gene. (J:309962)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nppb Mutation:  14 strains or lines available
References
Original:  J:309962 Man JCK, et al., Genetic Dissection of a Super Enhancer Controlling the Nppa-Nppb Cluster in the Heart. Circ Res. 2021 Jan 8;128(1):115-129
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory