Del(4Rr604540-Rr604541)3Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(4Rr604540-Rr604541)3Vmc
• Name: deletion, Chr4, Vincent M Christoffels 3
• MGI ID: MGI:7366916
• Synonyms: Del(4Rr103615-Rr93032)3Vmc, RE1b^-
• Gene: Del(4Rr604540-Rr604541)3Vmc Location: unknown Genetic Position: Chr4, Syntenic

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(4Rr604540-Rr604541)3Vmc involves 2 genes/genome features (Rr604540, Rr604541) View all
• Mutation details: The Nppa/Nppb superenhancer was targeted with sgRNAs (equivalent to GGCTTTTAACTTTACTGTTT and GGTTAATTGATTAAAAGTGG) using CRISPR/Cas9 technology, resulting in the deletion of enhancers Rr604540 and Rr604541. (J:309962)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(4Rr604540-Rr604541)3Vmc Mutation: 0 strains or lines available

References

• Original: J:309962 Man JCK, et al., Genetic Dissection of a Super Enhancer Controlling the Nppa-Nppb Cluster in the Heart. Circ Res. 2021 Jan 8;128(1):115-129
• All: 1 reference(s)