Del(4Rr604535-Rr604538)2Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(4Rr604535-Rr604538)2Vmc
• Name: deletion, Chr4, Vincent M Christoffels 2
• MGI ID: MGI:7366914
• Synonyms: Del(4Rr103613-Rr103614)2Vmc, RE1a^-
• Gene: Del(4Rr604535-Rr604538)2Vmc Location: unknown Genetic Position: Chr4, Syntenic

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(4Rr604535-Rr604538)2Vmc involves 3 genes/genome features (Rr604535, Rr604537, Rr604538) View all
• Mutation details: The Nppa/Nppb superenhancer was targeted with sgRNAs (equivalent to GGCATGTGCCTGATGCATAT and GGCTTTTAACTTTACTGTTT) using CRISPR/Cas9 technology, resulting in the deletion of enhancers Rr604535, Rr604537 and Rr604538. (J:309962)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(4Rr604535-Rr604538)2Vmc Mutation: 0 strains or lines available

References

• Original: J:309962 Man JCK, et al., Genetic Dissection of a Super Enhancer Controlling the Nppa-Nppb Cluster in the Heart. Circ Res. 2021 Jan 8;128(1):115-129
• All: 1 reference(s)