Dmrt1em1Zark
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dmrt1em1Zark |
| Name: |
doublesex and mab-3 related transcription factor 1; endonuclease-mediated mutation 1, David Zarkower |
| MGI ID: |
MGI:7366910 |
| Synonyms: |
Dmrt1R111G |
| Gene: |
Dmrt1 Location: Chr19:25483070-25581692 bp, + strand Genetic Position: Chr19, 20.45 cM, cytoband C2-C3
|
| Alliance: |
Dmrt1em1Zark page
|
|
| Strain of Origin: |
(FVB/NJ x B6(Cg)-Tyrc-2J/J)F1
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: CRISPR/cas9 endonuclease-mediated genome editing was used to create asparagine to glycine substitution at position 109 (R109G in the mouse, R111G in human) the using Ensembl Canonical Transcript: ENSMUST00000025755.11 Dmrt1-201. The CRISPR guide sequence was CCCGCTGTCGCTCCGCAATC and the repair template was 5'-GGCCACAAGCGCTTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGTCTGATCGCGGAGGGACAGCGGGTGATGGCCGCGCAGGTGGCCCTGAGAAGACAGCAGGCCCA-3'. The repair template includes two silent changes that remove the PAM sequence and generate a restriction enzyme recognition site, as well as R109G. The R109G mutation alters the DNA binding motif. The mutation models a de novo human mutation in DMRT1 associated with dominant complete gonadal dysgenesis and 46,XY sex reversal.
(J:330224)
|
|
|
|
|
|
|
| Original: |
J:330224 Murphy MW, et al., Genomics of sexual cell fate transdifferentiation in the mouse gonad. G3 (Bethesda). 2022 Oct 6; |
| All: |
1 reference(s) |
|