About   Help   FAQ
Dmrt1em1Zark
Endonuclease-mediated Allele Detail
Summary
Symbol: Dmrt1em1Zark
Name: doublesex and mab-3 related transcription factor 1; endonuclease-mediated mutation 1, David Zarkower
MGI ID: MGI:7366910
Synonyms: Dmrt1R111G
Gene: Dmrt1  Location: Chr19:25483070-25581692 bp, + strand  Genetic Position: Chr19, 20.45 cM, cytoband C2-C3
Alliance: Dmrt1em1Zark page
Mutation
origin
Strain of Origin:  (FVB/NJ x B6(Cg)-Tyrc-2J/J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing was used to create asparagine to glycine substitution at position 109 (R109G in the mouse, R111G in human) the using Ensembl Canonical Transcript: ENSMUST00000025755.11 Dmrt1-201. The CRISPR guide sequence was CCCGCTGTCGCTCCGCAATC and the repair template was 5'-GGCCACAAGCGCTTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGTCTGATCGCGGAGGGACAGCGGGTGATGGCCGCGCAGGTGGCCCTGAGAAGACAGCAGGCCCA-3'. The repair template includes two silent changes that remove the PAM sequence and generate a restriction enzyme recognition site, as well as R109G. The R109G mutation alters the DNA binding motif. The mutation models a de novo human mutation in DMRT1 associated with dominant complete gonadal dysgenesis and 46,XY sex reversal. (J:330224)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dmrt1 Mutation:  47 strains or lines available
References
Original:  J:330224 Murphy MW, et al., Genomics of sexual cell fate transdifferentiation in the mouse gonad. G3 (Bethesda). 2022 Oct 6;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory