Ndrg1^em1Lxli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ndrg1^em1Lxli
• Name: N-myc downstream regulated gene 1; endonuclease-mediated mutation 1, Li-Xi Li
• MGI ID: MGI:7366891
• Gene: Ndrg1 Location: Chr15:66801167-66841489 bp, - strand Genetic Position: Chr15, 29.3 cM, cytoband D3
• Alliance: Ndrg1^em1Lxli page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs GGGCCAACAACTTCCCATTCTGG and GTGTGACACCCCTTGTCTTGGGG generated an approximate 3.5 kb deletion encompassing exons 4 and 5. Western blot analysis confirmed the absence of protein in the sciatic nerve. (J:330126)

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ndrg1 Mutation: 27 strains or lines available

References

• Original: J:330126 Jiang LT, et al., Aberrant Neuregulin 1/ErbB Signaling in Charcot-Marie-Tooth Type 4D Disease. Mol Cell Biol. 2022 Jul 21;42(7):e0055921
• All: 1 reference(s)