Rr296^em1Hzo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr296^em1Hzo
• Name: regulatory region 296; endonuclease-mediated mutation 1, Huda Y Zoghbi
• MGI ID: MGI:7356641
• Synonyms: Peak-6^KO
• Gene: Rr296 Location: unknown Genetic Position: ChrX, Syntenic
• Alliance: Rr296^em1Hzo page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Mecp2 silencer 31 kb upstream of the gene was targeted with sgRNAs (targeting AAAAGGATATGGGATACTAG and GGTCCCCAATAGGGTCACCA) using CRISPR/Cas9 technology, resulting in a 1440 bp deletion. (J:311942)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr296 Mutation: 0 strains or lines available

References

• Original: J:311942 Shao Y, et al., Identification and characterization of conserved noncoding cis-regulatory elements that impact Mecp2 expression and neurological functions. Genes Dev. 2021 Apr 1;35(7-8):489-494
• All: 1 reference(s)