Gpn1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gpn1em1(IMPC)J |
| Name: |
GPN-loop GTPase 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7356629 |
| Synonyms: |
Gpn1- |
| Gene: |
Gpn1 Location: Chr5:31652085-31670248 bp, + strand Genetic Position: Chr5, 17.27 cM
|
| Alliance: |
Gpn1em1(IMPC)J page
|
| IMPC: |
Gpn1 gene page |
|
Gpn1em1(IMPC)J/Gpn1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTTCCTGGGGTACTACT and TGACGTGGAGAAACTTTCAG, which resulted in a 2433 bp deletion beginning at Chromosome 5 position 31,497,093 bp and ending after 31,499,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001228555, ENSMUSE00001229512, and ENSMUSE00001247942 (exons 3,4, and 5) and 2282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 2 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|