Fbxo48^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fbxo48^em1(IMPC)J
• Name: F-box protein 48; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7356592
• Gene: Fbxo48 Location: Chr11:16901375-16904772 bp, + strand Genetic Position: Chr11, 9.41 cM
• Alliance: Fbxo48^em1(IMPC)J page
• IMPC: Fbxo48 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTGACTCTGTTAGCTCGA and TTAAACTTGATCTAATCTTG, which resulted in a 1972 bp deletion beginning at Chromosome 11 position 16,952,904 bp and ending after 16,954,875 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000442598, ENSMUSE00000344823, and ENSMUSE00000388108 (exons 2,3,and 4) and 910 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fbxo48 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)