Zfp28^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp28^em1(IMPC)J
• Name: zinc finger protein 28; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7356590
• Gene: Zfp28 Location: Chr7:6386317-6399636 bp, + strand Genetic Position: Chr7, 3.7 cM
• Alliance: Zfp28^em1(IMPC)J page
• IMPC: Zfp28 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACGATCACAGGTCACCAGA and GTAAGACTGACAGGGAAAGG, which resulted in a 602 bp deletion beginning at Chromosome 7 position 6,389,393 bp and ending after 6,389,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000992229 and ENSMUSE00000464573 (exons 3 and 4) and 379 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp28 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)