About   Help   FAQ
Zfp28em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp28em1(IMPC)J
Name: zinc finger protein 28; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7356590
Gene: Zfp28  Location: Chr7:6386317-6399636 bp, + strand  Genetic Position: Chr7, 3.7 cM
Alliance: Zfp28em1(IMPC)J page
IMPC: Zfp28 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACGATCACAGGTCACCAGA and GTAAGACTGACAGGGAAAGG, which resulted in a 602 bp deletion beginning at Chromosome 7 position 6,389,393 bp and ending after 6,389,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000992229 and ENSMUSE00000464573 (exons 3 and 4) and 379 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp28 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/26/2026
MGI 6.24
The Jackson Laboratory