Rasgef1cem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rasgef1cem1(IMPC)J |
| Name: |
RasGEF domain family, member 1C; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7356585 |
| Gene: |
Rasgef1c Location: Chr11:49791996-49871050 bp, + strand Genetic Position: Chr11, 30.02 cM, cytoband B1.2
|
| Alliance: |
Rasgef1cem1(IMPC)J page
|
| IMPC: |
Rasgef1c gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTATCCGCAGAATCACAG and GTCCACTTTCACCTGTCTGG, which resulted in a 2685 bp deletion beginning at Chromosome 11 position 49,966,962 bp and ending after 49,969,646 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287950 and ENSMUSE00001274105 (exons 7 and 8) and 2492 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 238 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|