Fmn1em2Zllr
Endonuclease-mediated Allele Detail
|
Symbol: |
Fmn1em2Zllr |
Name: |
formin 1; endonuclease-mediated mutation 2, Rolf Zeller |
MGI ID: |
MGI:7346403 |
Synonyms: |
EC2delta |
Gene: |
Fmn1 Location: Chr2:113158081-113547112 bp, + strand Genetic Position: Chr2, 57.3 cM, cytoband C1-qter
|
Alliance: |
Fmn1em2Zllr page
|
|
Strain of Origin: |
Not Applicable
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region, Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Fmn1em2Zllr involves 2 genes/genome features (Rr286, Rr287)
View all
|
|
|
Mutation details: An enhancer cluster containing Grem1 limb regulatory regions Rr287 (CRM5) and Rr286 (CRM7), located in Fmn1 introns 12 and 6 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting TTCAGCTGCATTGCGTCCTA and AGTCAAGGACACACGCTGTA) using CRISPR/Cas9 technology, resulting in a 34.3 kb deletion (chr2:113402655-113436919 GRCm39) from intron 6 to 12 (so including exons 7-12).
(J:312378)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Fmn1 Mutation: |
74 strains or lines available
|
|
Original: |
J:312378 Malkmus J, et al., Spatial regulation by multiple Gremlin1 enhancers provides digit development with cis-regulatory robustness and evolutionary plasticity. Nat Commun. 2021 Sep 21;12(1):5557 |
All: |
1 reference(s) |
|