About   Help   FAQ
Rr26em1Zllr
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr26em1Zllr
Name: regulatory region 26; endonuclease-mediated mutation 1, Rolf Zeller
MGI ID: MGI:7346401
Synonyms: CRM4delta
Gene: Rr26  Location: unknown  Genetic Position: Chr2, Syntenic
Alliance: Rr26em1Zllr page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThis Grem1 limb regulatory region, located in Fmn1 intron 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGCAGCCTATAATTCTCAGCGC and AAACGCGCTGAGAATTATAGGCTGC) using CRISPR/Cas9 technology, resulting in a 1.1 kb deletion (chr2:113470863-113471933 GRCm39). (J:312378)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr26 Mutation:  0 strains or lines available
References
Original:  J:312378 Malkmus J, et al., Spatial regulation by multiple Gremlin1 enhancers provides digit development with cis-regulatory robustness and evolutionary plasticity. Nat Commun. 2021 Sep 21;12(1):5557
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory