2410004P03Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 2410004P03Rik^em1(IMPC)J
• Name: RIKEN cDNA 2410004P03 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7346375
• Gene: 2410004P03Rik Location: Chr12:17054958-17061759 bp, - strand Genetic Position: Chr12, 8.04 cM
• Alliance: 2410004P03Rik^em1(IMPC)J page
• IMPC: 2410004P03Rik gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCTGACCGCATAACCATG and GGACCCTGAGTTCTCCACCA, which resulted in a 4969 bp deletion beginning at Chromosome 12 position 17,006,818 bp and ending after 17,011,786 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615977, ENSMUSE00000615976, ENSMUSE00000615975, and ENSMUSE00000615974 (exons 1-4) and 4212 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 2410004P03Rik Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)