2410004P03Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
2410004P03Rikem1(IMPC)J |
Name: |
RIKEN cDNA 2410004P03 gene; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7346375 |
Gene: |
2410004P03Rik Location: Chr12:17054958-17061759 bp, - strand Genetic Position: Chr12, 8.04 cM
|
Alliance: |
2410004P03Rikem1(IMPC)J page
|
IMPC: |
2410004P03Rik gene page |
|
Strain of Origin: |
Not Applicable
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCTGACCGCATAACCATG and GGACCCTGAGTTCTCCACCA, which resulted in a 4969 bp deletion beginning at Chromosome 12 position 17,006,818 bp and ending after 17,011,786 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615977, ENSMUSE00000615976, ENSMUSE00000615975, and ENSMUSE00000615974 (exons 1-4) and 4212 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|