Rgs2^em1Jgro
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rgs2^em1Jgro
• Name: regulator of G-protein signaling 2; endonuclease-mediated mutation 1, Justin Grobe
• MGI ID: MGI:7346183
• Synonyms: Rgs2^flox
• Gene: Rgs2 Location: Chr1:143875076-143879887 bp, - strand Genetic Position: Chr1, 62.56 cM
• Alliance: Rgs2^em1Jgro page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1/J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs (ATGAGCTTTACAAGCAGGAT and GCTGGGATGAGAGGCGCACA) toinsert loxP sited in the introns flanking exons 2-4. Rgs2 transcript Rgs2-202 was used as reference for the exon number and the guide sequences. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rgs2 Mutation: 21 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)