Timm17bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Timm17bem1(IMPC)J |
Name: |
translocase of inner mitochondrial membrane 17b; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7343917 |
Gene: |
Timm17b Location: ChrX:7765575-7773891 bp, + strand Genetic Position: ChrX, 3.56 cM
|
Alliance: |
Timm17bem1(IMPC)J page
|
IMPC: |
Timm17b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGCAGCCAAAGAACCAGG and CCCCACAGTCTAATATGAAA, which resulted in a 414 bp deletion beginning at Chromosome X position 7,903,461 bp and ending after 7,903,874 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000206943 (exon 3) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 34 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|