Nudt16l1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Nudt16l1em1(IMPC)J |
Name: |
nudix hydrolase 16 like 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7343888 |
Gene: |
Nudt16l1 Location: Chr16:4756975-4758892 bp, + strand Genetic Position: Chr16, 2.48 cM, cytoband A1
|
Alliance: |
Nudt16l1em1(IMPC)J page
|
IMPC: |
Nudt16l1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTCCAGCTCAAGTGACAG and CTGAGGGCAACCAATCTCAG, which resulted in a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001438399, ENSMUSE00000127761, and ENSMUSE00001442417 (exons 1-3) and 825 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|