Cst7^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cst7^em1Aduci
• Name: cystatin F (leukocystatin); endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:7341818
• Gene: Cst7 Location: Chr2:150412335-150420864 bp, + strand Genetic Position: Chr2, 74.67 cM, cytoband G1-G3
• Alliance: Cst7^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Alt-R CRISPR RNAs (CCTGCATTTCCCCAGCCATG and AAGCAGAATGGCCAGCCACA) are designed delete part of exon 1 and intron 1. Specifically, 168 bp of contiguous DNA from nucleotide position 150,412,438 to 150,412,605 inclusive (nucleotide position from mouse genome build GRCm39, Ensembl release 107). The deletion begins one nucleotide upstream of the translation initiation ATG codon in exon 1 and extends 100 nucleotides into intron 1. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cst7 Mutation: 20 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)