Rreb1^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rreb1^em1Tcp
• Name: ras responsive element binding protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7339258
• Synonyms: Rreb1^em1Rtpl
• Gene: Rreb1 Location: Chr13:37962376-38135981 bp, + strand Genetic Position: Chr13, Syntenic
• Alliance: Rreb1^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by injecting Cas9 mRNA with single guide RNAs having spacer sequences of CCAGCTGACTACATGGCAAG and CTCGGCTGCAGGAAGTACAC targeting the 5' side and GAAAACTCGTAGTGGCACAG and CGTTACAACAAAGCACCCTT targeting the 3' side of a critical region (ENSMUSE00001260546). This resulted in a 1123-bp deletion of Chr13:38082958 to 38084080 (GRCm39) introducing a frameshift and premature stop codon. (J:296982)

Disease models

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rreb1 Mutation: 163 strains or lines available

References

• Original: J:296982 Kent OA, et al., Haploinsufficiency of RREB1 causes a Noonan-like RASopathy via epigenetic reprogramming of RAS-MAPK pathway genes. Nat Commun. 2020 Sep 16;11(1):4673
• All: 1 reference(s)