Ryr1^em1Zor
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ryr1^em1Zor
• Name: ryanodine receptor 1, skeletal muscle; endonuclease-mediated mutation 1, Francesco Zorzato
• MGI ID: MGI:7339039
• Synonyms: RyR1Q1970fsX16
• Gene: Ryr1 Location: Chr7:28702765-28824599 bp, - strand Genetic Position: Chr7, 16.94 cM, cytoband A2-B3
• Alliance: Ryr1^em1Zor page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Insertion
• Mutation details: Starting at glutamine codon 1971 in exon 36, sequence CA was replaced with ACAGCT (effectively a 4-bp insertion) using an sgRNA (targeting AAGATGCAGGGCAACCAGCGGGG ) and an ssODN template with CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (ENSMUSP00000137123:p.Q1971Tfs*49). The mutation mimics the similar human c.5908C>T:p.Q1970* and c.5938delC:p.L1980Sfs*1 premature stop codon mutations associated with congenital myopathy 1B (multiminicore disease (MmD)). (J:292405)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ryr1 Mutation: 214 strains or lines available

References

• Original: J:292405 Elbaz M, et al., Quantitative RyR1 reduction and loss of calcium sensitivity of RyR1Q1970fsX16+A4329D cause cores and loss of muscle strength. Hum Mol Genet. 2019 Sep 15;28(18):2987-2999
• All: 4 reference(s)