About   Help   FAQ
Ryr1em1Zor
Endonuclease-mediated Allele Detail
Summary
Symbol: Ryr1em1Zor
Name: ryanodine receptor 1, skeletal muscle; endonuclease-mediated mutation 1, Francesco Zorzato
MGI ID: MGI:7339039
Synonyms: RyR1Q1970fsX16
Gene: Ryr1  Location: Chr7:28702765-28824599 bp, - strand  Genetic Position: Chr7, 16.94 cM, cytoband A2-B3
Alliance: Ryr1em1Zor page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Insertion
 
Mutation detailsStarting at glutamine codon 1971 in exon 36, sequence CA was replaced with ACAGCT (effectively a 4-bp insertion) using an sgRNA (targeting AAGATGCAGGGCAACCAGCGGGG ) and an ssODN template with CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (ENSMUSP00000137123:p.Q1971Tfs*49). The mutation mimics the similar human c.5908C>T:p.Q1970* and c.5938delC:p.L1980Sfs*1 premature stop codon mutations associated with congenital myopathy 1B (multiminicore disease (MmD)). (J:292405)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ryr1 Mutation:  215 strains or lines available
References
Original:  J:292405 Elbaz M, et al., Quantitative RyR1 reduction and loss of calcium sensitivity of RyR1Q1970fsX16+A4329D cause cores and loss of muscle strength. Hum Mol Genet. 2019 Sep 15;28(18):2987-2999
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory