Ryr1em1Zor
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ryr1em1Zor |
| Name: |
ryanodine receptor 1, skeletal muscle; endonuclease-mediated mutation 1, Francesco Zorzato |
| MGI ID: |
MGI:7339039 |
| Synonyms: |
RyR1Q1970fsX16 |
| Gene: |
Ryr1 Location: Chr7:28702765-28824599 bp, - strand Genetic Position: Chr7, 16.94 cM, cytoband A2-B3
|
| Alliance: |
Ryr1em1Zor page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: Starting at glutamine codon 1971 in exon 36, sequence CA was replaced with ACAGCT (effectively a 4-bp insertion) using an sgRNA (targeting AAGATGCAGGGCAACCAGCGGGG ) and an ssODN template with CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (ENSMUSP00000137123:p.Q1971Tfs*49). The mutation mimics the similar human c.5908C>T:p.Q1970* and c.5938delC:p.L1980Sfs*1 premature stop codon mutations associated with congenital myopathy 1B (multiminicore disease (MmD)).
(J:292405)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ryr1 Mutation: |
216 strains or lines available
|
|
| Original: |
J:292405 Elbaz M, et al., Quantitative RyR1 reduction and loss of calcium sensitivity of RyR1Q1970fsX16+A4329D cause cores and loss of muscle strength. Hum Mol Genet. 2019 Sep 15;28(18):2987-2999 |
| All: |
4 reference(s) |
|