About   Help   FAQ
Rr268em2Hino
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr268em2Hino
Name: regulatory region 268; endonuclease-mediated mutation 2, Hirofumi Noguchi
MGI ID: MGI:7338999
Synonyms: 2C1
Gene: Rr268  Location: Chr7:142233564-142233596 bp  Genetic Position: Chr7, Syntenic
Alliance: Rr268em2Hino page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe GG2-GG1/A2-C1 enhancer element of the Ins2 promoter was targeted with sgRNAs (targeting CTTTCTGCAGACCTAGCACCAGG and AAACTGCAGCTTCAGCCCCTCTGG) using CRISPR/Cas9 technology, resulting in a 3 bp deletion (CCC) in the C1 element. (J:312429)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr268 Mutation:  0 strains or lines available
References
Original:  J:312429 Noguchi H, et al., In vivo evaluation of GG2-GG1/A2 element activity in the insulin promoter region using the CRISPR-Cas9 system. Sci Rep. 2021 Oct 13;11(1):20290
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory