About   Help   FAQ
Cenpaem1Ligu
Endonuclease-mediated Allele Detail
Summary
Symbol: Cenpaem1Ligu
Name: centromere protein A; endonuclease-mediated mutation 1, Guohong Li
MGI ID: MGI:7336233
Synonyms: CENP-A S62A
Gene: Cenpa  Location: Chr5:30824214-30832181 bp, + strand  Genetic Position: Chr5, 16.76 cM
Alliance: Cenpaem1Ligu page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 62 (AGC) in exon 2 was changed to alanine (p.S62A) using an sgRNA (targeting GGAACTTACAACCATGCTGA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.S68A mutation and prevents phosphorylation of the residue. (J:328357)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cenpa Mutation:  15 strains or lines available
References
Original:  J:328357 Wang K, et al., Phosphorylation at Ser68 facilitates DCAF11-mediated ubiquitination and degradation of CENP-A during the cell cycle. Cell Rep. 2021 Nov 9;37(6):109987
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory