Arid5a^em1Gaff
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arid5a^em1Gaff
• Name: AT-rich interaction domain 5A; endonuclease-mediated mutation 1, Sarah Gaffen
• MGI ID: MGI:7334831
• Gene: Arid5a Location: Chr1:36346814-36363110 bp, + strand Genetic Position: Chr1, 15.2 cM
• Alliance: Arid5a^em1Gaff page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing uses sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7). (J:331508)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arid5a Mutation: 33 strains or lines available

References

• Original: J:331508 Taylor TC, et al., Arid5a Mediates an IL-17-Dependent Pathway That Drives Autoimmunity but Not Antifungal Host Defense. J Immunol. 2022 Sep 15;209(6):1138-1145
• All: 1 reference(s)