About   Help   FAQ
Arid5aem1Gaff
Endonuclease-mediated Allele Detail
Summary
Symbol: Arid5aem1Gaff
Name: AT-rich interaction domain 5A; endonuclease-mediated mutation 1, Sarah Gaffen
MGI ID: MGI:7334831
Gene: Arid5a  Location: Chr1:36346814-36363110 bp, + strand  Genetic Position: Chr1, 15.2 cM
Alliance: Arid5aem1Gaff page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing uses sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7). (J:331508)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arid5a Mutation:  33 strains or lines available
References
Original:  J:331508 Taylor TC, et al., Arid5a Mediates an IL-17-Dependent Pathway That Drives Autoimmunity but Not Antifungal Host Defense. J Immunol. 2022 Sep 15;209(6):1138-1145
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory