Il4ra^em1Amen
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il4ra^em1Amen
• Name: interleukin 4 receptor, alpha; endonuclease-mediated mutation 1, Sarah Amend
• MGI ID: MGI:7334731
• Gene: Il4ra Location: Chr7:125151443-125178646 bp, + strand Genetic Position: Chr7, 68.94 cM
• Alliance: Il4ra^em1Amen page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs to target upstream [CACCACGTTAAAGCACAGGG; GCTCCCACCACTAAGGTCAG] and downstream [GCTTGTGGCAGCTTACTGAG; GCTCAACTGTAGTATCACGC] of exon 4. Il4ra transcript Il4ra-201 was used as reference for the exon number and the guide sequences (J:341579)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Il4ra Mutation: 41 strains or lines available

References

• Original: J:341579 de Groot AE, et al., Targeting interleukin 4 receptor alpha on tumor-associated macrophages reduces the pro-tumor macrophage phenotype. Neoplasia. 2022 Oct;32:100830
• All: 1 reference(s)