About   Help   FAQ
Il4raem1Amen
Endonuclease-mediated Allele Detail
Summary
Symbol: Il4raem1Amen
Name: interleukin 4 receptor, alpha; endonuclease-mediated mutation 1, Sarah Amend
MGI ID: MGI:7334731
Gene: Il4ra  Location: Chr7:125151443-125178646 bp, + strand  Genetic Position: Chr7, 68.94 cM
Alliance: Il4raem1Amen page
Mutation
origin
Strain of Origin:  FVB/NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing uses guide RNAs to target upstream [CACCACGTTAAAGCACAGGG; GCTCCCACCACTAAGGTCAG] and downstream [GCTTGTGGCAGCTTACTGAG; GCTCAACTGTAGTATCACGC] of exon 4. Il4ra transcript Il4ra-201 was used as reference for the exon number and the guide sequences (J:341579)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Il4ra Mutation:  43 strains or lines available
References
Original:  J:341579 de Groot AE, et al., Targeting interleukin 4 receptor alpha on tumor-associated macrophages reduces the pro-tumor macrophage phenotype. Neoplasia. 2022 Oct;32:100830
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory