About   Help   FAQ
Rr253em2Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr253em2Kmm
Name: regulatory region 253; endonuclease-mediated mutation 2, Kenneth M Murphy
MGI ID: MGI:7331607
Synonyms: Zeb2delta-165
Gene: Rr253  Location: Chr2:45169490-45169853 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr253em2Kmm page
Mutation
origin
Strain of Origin:  STOCK Zeb2tm2.1Yhi/2YhiRbrc
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 368 bp deletion. The allele was created in zygotes containing the Zeb2tm2.1Yhi allele. (J:316113)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr253 Mutation:  2 strains or lines available
References
Original:  J:316113 Huang X, et al., Differential usage of transcriptional repressor Zeb2 enhancers distinguishes adult and embryonic hematopoiesis. Immunity. 2021 Jul 13;54(7):1417-1432.e7
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory