About   Help   FAQ
Smim17em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Smim17em1(IMPC)J
Name: small integral membrane protein 17; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7331568
Gene: Smim17  Location: Chr7:6418193-6434085 bp, + strand  Genetic Position: Chr7, 3.71 cM
Alliance: Smim17em1(IMPC)J page
IMPC: Smim17 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAACACTAGAAAGAGAGCA and ATAGACTGTGCATATCCACA, which resulted in a 7666 bp deletion beginning at Chromosome 7 position 6,427,547 bp and ending after 6,435,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308241, ENSMUSE00001279438, ENSMUSE00000864604 (exons 2, 3, and 4) and 4539 bp of intronic sequence including the splice acceptor and donor the start site and 3 UTR and is predicted to result in a null allele. There is a 3 bp deletion (GTC) 5 bases after the 3 coordinate. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Smim17 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory