Smim17em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Smim17em1(IMPC)J |
| Name: |
small integral membrane protein 17; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7331568 |
| Gene: |
Smim17 Location: Chr7:6418193-6434085 bp, + strand Genetic Position: Chr7, 3.71 cM
|
| Alliance: |
Smim17em1(IMPC)J page
|
| IMPC: |
Smim17 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAACACTAGAAAGAGAGCA and ATAGACTGTGCATATCCACA, which resulted in a 7666 bp deletion beginning at Chromosome 7 position 6,427,547 bp and ending after 6,435,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308241, ENSMUSE00001279438, ENSMUSE00000864604 (exons 2, 3, and 4) and 4539 bp of intronic sequence including the splice acceptor and donor the start site and 3 UTR and is predicted to result in a null allele. There is a 3 bp deletion (GTC) 5 bases after the 3 coordinate.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|