About   Help   FAQ
Irgqem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Irgqem1(IMPC)J
Name: immunity-related GTPase family, Q; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7331504
Gene: Irgq  Location: Chr7:24230114-24238025 bp, + strand  Genetic Position: Chr7, 11.32 cM
Alliance: Irgqem1(IMPC)J page
IMPC: Irgq gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTGAATCAGTTAGGAGA and CCATGTGCTTGTCTACGGAG, which resulted in a 7630 bp deletion beginning at Chromosome 7 position 24,531,163 bp and ending after 24,538,792 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000404079 and ENSMUSE00000317876 (exons 2 and 3) and 1763 bp of intronic sequence including the splice acceptor and donor the start site and 3 UTR and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Irgq Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory