Rr249^em2Ebres
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr249^em2Ebres
• Name: regulatory region 249; endonuclease-mediated mutation 2, Emery H Bresnick
• MGI ID: MGI:7330390
• Synonyms: Gata2 +9.5(Ets)^-
• Gene: Rr249 Location: Chr6:88180138-88180212 bp Genetic Position: Chr6, Syntenic
• Alliance: Rr249^em2Ebres page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: The intronic Gata2 enhancer was targeted with an sgRNA (targeting TCTCCTGCCGGAGTTTCCTATCCGG) and an ssODN template (TTTCAAAACAGCCCAGCAAGAGGCAGGACTGAGTCGAGGTGGCTCTGAAAACTTGCCGGTCCAGAAACAGATACACGAAGTTTCCTTATCTACCGGCTGCAGATGTCCGGATAGGAAACTCCGGC) using CRISPR/Cas9 technology, resulting in a C-to-T mutation disabling the Ets motif TTCC by changing it to TTCT. (J:295045)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr249 Mutation: 0 strains or lines available

References

• Original: J:295045 Soukup AA, et al., Single-nucleotide human disease mutation inactivates a blood-regenerative GATA2 enhancer. J Clin Invest. 2019 Mar 1;129(3):1180-1192
• All: 2 reference(s)