About   Help   FAQ
Rr249em1Ebres
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr249em1Ebres
Name: regulatory region 249; endonuclease-mediated mutation 1, Emery H Bresnick
MGI ID: MGI:7330389
Synonyms: Gata2 +9.5(E-box)-
Gene: Rr249  Location: Chr6:88180138-88180212 bp  Genetic Position: Chr6, Syntenic
Alliance: Rr249em1Ebres page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe intronic Gata2 enhancer was targeted with an sgRNA (targeting TCTCCTGCCGGAGTTTCCTATCCGG) using CRISPR/Cas9 technology, resulting in a 28 bp deletion (CCTGCCGGAGTTTCCTATCCGGACATCT) that deletes the critical C from the CATCTG E-box sequence. (J:295045)
Expression
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr249 Mutation:  0 strains or lines available
References
Original:  J:295045 Soukup AA, et al., Single-nucleotide human disease mutation inactivates a blood-regenerative GATA2 enhancer. J Clin Invest. 2019 Mar 1;129(3):1180-1192
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory