About   Help   FAQ
Fam204aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam204aem1(IMPC)J
Name: family with sequence similarity 204, member A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7330328
Gene: Fam204a  Location: Chr19:60187018-60215133 bp, - strand  Genetic Position: Chr19, 56.52 cM, cytoband D3
Alliance: Fam204aem1(IMPC)J page
IMPC: Fam204a gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTATTCAGCAGTGTTGT and ATATGTCTGCCAATGACCTA, which resulted in a 1214 bp deletion beginning at Chromosome 19 position 60,220,288 bp and ending after 60,221,501 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001073564, ENSMUSE00000459773,and ENSMUSE00000511602 (exons 2, 3 and 4) and 844 bp of intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fam204a Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory