Fam204a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam204a^em1(IMPC)J
• Name: family with sequence similarity 204, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330328
• Gene: Fam204a Location: Chr19:60187018-60215133 bp, - strand Genetic Position: Chr19, 56.52 cM, cytoband D3
• Alliance: Fam204a^em1(IMPC)J page
• IMPC: Fam204a gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTATTCAGCAGTGTTGT and ATATGTCTGCCAATGACCTA, which resulted in a 1214 bp deletion beginning at Chromosome 19 position 60,220,288 bp and ending after 60,221,501 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001073564, ENSMUSE00000459773,and ENSMUSE00000511602 (exons 2, 3 and 4) and 844 bp of intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam204a Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)