Siral2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Siral2^em1(IMPC)J
• Name: SIR2 antiphage like 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330324
• Gene: Siral2 Location: Chr15:84913149-84947031 bp, + strand Genetic Position: Chr15, 40.25 cM, cytoband E3
• Alliance: Siral2^em1(IMPC)J page
• IMPC: Siral2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTGTGGCTACATAGGGGA and AATTCTGCTTGGAGAAGTGA, which resulted in a 3638 bp deletion beginning at Chromosome 15 position 85,050,459 bp and ending after 85,054,096 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126537 and ENSMUSE00000126531 (exons 5 and 6) and 3223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 50 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Siral2 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)