About   Help   FAQ
Siral2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Siral2em1(IMPC)J
Name: SIR2 antiphage like 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7330324
Gene: Siral2  Location: Chr15:84913149-84947031 bp, + strand  Genetic Position: Chr15, 40.25 cM, cytoband E3
Alliance: Siral2em1(IMPC)J page
IMPC: Siral2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTGTGGCTACATAGGGGA and AATTCTGCTTGGAGAAGTGA, which resulted in a 3638 bp deletion beginning at Chromosome 15 position 85,050,459 bp and ending after 85,054,096 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126537 and ENSMUSE00000126531 (exons 5 and 6) and 3223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 50 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Siral2 Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory