Nup62clem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Nup62clem1(IMPC)J |
Name: |
nucleoporin 62 C-terminal like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7330226 |
Gene: |
Nup62cl Location: ChrX:138907551-138963456 bp, - strand Genetic Position: ChrX, 61.35 cM
|
Alliance: |
Nup62clem1(IMPC)J page
|
IMPC: |
Nup62cl gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGGACTTCATATCTCTAGA and AGATTGGAGAATCTCCCCAC, which resulted in a 3283 bp deletion beginning at Chromosome X position 140,025,108 bp and ending after 140,028,390 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653522, ENSMUSE00000653521, ENSMUSE00000653519 and ENSMUSE00000653518 (exons 4-7) and 2835 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|