Nup62cl^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nup62cl^em1(IMPC)J
• Name: nucleoporin 62 C-terminal like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330226
• Gene: Nup62cl Location: ChrX:138907551-138963456 bp, - strand Genetic Position: ChrX, 61.35 cM
• Alliance: Nup62cl^em1(IMPC)J page
• IMPC: Nup62cl gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGGACTTCATATCTCTAGA and AGATTGGAGAATCTCCCCAC, which resulted in a 3283 bp deletion beginning at Chromosome X position 140,025,108 bp and ending after 140,028,390 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653522, ENSMUSE00000653521, ENSMUSE00000653519 and ENSMUSE00000653518 (exons 4-7) and 2835 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nup62cl Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)