Ccdc184em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ccdc184em1(IMPC)J |
Name: |
coiled-coil domain containing 184; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7330216 |
Gene: |
Ccdc184 Location: Chr15:98065687-98068015 bp, + strand Genetic Position: Chr15, 54.17 cM
|
Alliance: |
Ccdc184em1(IMPC)J page
|
IMPC: |
Ccdc184 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGCTATTTAAAGCGCTG and ATACCCGGCCCGGCTAACAA, which resulted in a 3243 bp deletion beginning at Chromosome 15 position 98,167,142 bp and ending after 98,170,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409713 (exon 1) and 266 bp of flanking sequence including the splice acceptor and donor and start site as well as 3UTR and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|