About   Help   FAQ
Ccdc184em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc184em1(IMPC)J
Name: coiled-coil domain containing 184; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7330216
Gene: Ccdc184  Location: Chr15:98065687-98068015 bp, + strand  Genetic Position: Chr15, 54.17 cM
Alliance: Ccdc184em1(IMPC)J page
IMPC: Ccdc184 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGCTATTTAAAGCGCTG and ATACCCGGCCCGGCTAACAA, which resulted in a 3243 bp deletion beginning at Chromosome 15 position 98,167,142 bp and ending after 98,170,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409713 (exon 1) and 266 bp of flanking sequence including the splice acceptor and donor and start site as well as 3UTR and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc184 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory