Syngr2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syngr2^em1(IMPC)J
• Name: synaptogyrin 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7329961
• Gene: Syngr2 Location: Chr11:117700494-117705109 bp, + strand Genetic Position: Chr11, 82.96 cM
• Alliance: Syngr2^em1(IMPC)J page
• IMPC: Syngr2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTAGGACATATTTCCCAG and CTAGGGGTGGAGATACACTT, which resulted in a 4837 bp deletion beginning at Chromosome 11 position 117,809,495 bp and ending after 117,814,331 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246954, ENSMUSE00000151668, ENSMUSE00001250072 and ENSMUSE00000402864 (exons 1-4) and 866 bp of flanking intronic sequence including the start site, splice acceptor and donor as well as 3 UTR and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Syngr2 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)