About   Help   FAQ
Ramacem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ramacem1(IMPC)J
Name: RNA guanine-7 methyltransferase activating subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7328450
Synonyms: Ramac-
Gene: Ramac  Location: Chr7:81412701-81419238 bp, + strand  Genetic Position: Chr7, 45.71 cM
Alliance: Ramacem1(IMPC)J page
IMPC: Ramac gene page
Ramacem1(IMPC)J/Ramacem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos show severe developmental delay as small egg cylinders, poorly organized extraembryonic tissues and failure of gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCTTGACTACACTACGCTAT and TCATTACCACATAAATAAAT, which resulted in a 2137 bp deletion beginning at Chromosome 7 position 81,767,381 bp and ending after 81,769,517 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000311576 and ENSMUSE00000423698 (exons 2 and 3) and 817 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ramac Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory