Prr32^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prr32^em1(IMPC)J
• Name: proline rich 32; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7328448
• Gene: Prr32 Location: ChrX:44179805-44181668 bp, + strand Genetic Position: ChrX, 24.11 cM, cytoband A3.1
• Alliance: Prr32^em1(IMPC)J page
• IMPC: Prr32 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGTGAAGTCATCAGTTGCT and CTACATGCCTAAAGCTAGGA, which resulted in a 2206 bp deletion beginning at Chromosome X position 45,090,823 bp and ending after 45,093,028 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000470701 and ENSMUSE00000323019 (exons 1 and 2) and 1096 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prr32 Mutation: 5 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)