4933405L10Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4933405L10Rik^em1(IMPC)J
• Name: RIKEN cDNA 4933405L10 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7328446
• Gene: 4933405L10Rik Location: Chr8:106434921-106436877 bp, + strand Genetic Position: Chr8, 53.04 cM, cytoband D2
• Alliance: 4933405L10Rik^em1(IMPC)J page
• IMPC: 4933405L10Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CTAAGGCGAACAGCCTTCTG and GCTGGTCGTGTGGATCAGTG, which resulted in a 2081 bp deletion beginning at Chromosome 8 position 105,708,250 bp and ending after 105,710,330 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214417, ENSMUSE00000214420, ENSMUSE00000214418 and ENSMUSE00000214419 (exons 1, 2, 3 and 4) and 867 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 4933405L10Rik Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)