Alkal2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Alkal2em1(IMPC)J |
Name: |
ALK and LTK ligand 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7328421 |
Gene: |
Alkal2 Location: Chr12:30934323-30943855 bp, + strand Genetic Position: Chr12, 13.0 cM
|
Alliance: |
Alkal2em1(IMPC)J page
|
IMPC: |
Alkal2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATCCATACTACAATGCAC and CACTTAGCTGATCTCAGCAG, which resulted in a 3391 bp deletion beginning at Chromosome 12 position 30,886,935 bp and ending after 30,890,325 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435238, ENSMUSE00000435234 and ENSMUSE00000435241(exons 2, 3 and 4) and 3190 bp of intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|