Gaa^em2Jhng
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gaa^em2Jhng
• Name: glucosidase, alpha, acid; endonuclease-mediated mutation 2, Jeffrey Huang
• MGI ID: MGI:7327566
• Synonyms: Gaa^c.1935CA>
• Gene: Gaa Location: Chr11:119158789-119176284 bp, + strand Genetic Position: Chr11, 83.35 cM, cytoband D-E
• Alliance: Gaa^em2Jhng page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNAs (CGCAGATGTCCGCCCCGACC and GCAGATGTCCGCCCCGACCA) were designed to create a GAC to GAA mutation at position 1935, resulting in an aspartic acid to glutamic acid change at amino acid 645 (Asp645Glu). This mutation has been identified as the most frequent GAA pathogenic mutation in people of Taiwanese and Southern Han Chinese ethnicity, causing infantile-onset Pompe disease (IOPD). A silent protospacer adjacent motif (PAM) site mutation (Gaa(c.1920C to T)) and a gRNA seed region mutation (Gaa(c.1923G to C)) were introduced, as well as two silent mutations (Gaa(c.1929G to A) and Gaa(c.1932G to A)) to prevent gRNA editing of the donor template. (J:341582)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gaa Mutation: 54 strains or lines available

References

• Original: J:341582 Kan SH, et al., CRISPR-mediated generation and characterization of a Gaa homozygous c.1935C>A (p.D645E) Pompe disease knock-in mouse model recapitulating human infantile onset-Pompe disease. Sci Rep. 2022 Dec 14;12(1):21576
• All: 1 reference(s)