About   Help   FAQ
Rr44608em2Ddu
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr44608em2Ddu
Name: regulatory region 44608; endonuclease-mediated mutation 2, Denis Duboule
MGI ID: MGI:7327109
Synonyms: Del(CBS1), deltaCB1'
Gene: Rr44608  Location: Chr2:74546001-74546200 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr44608em2Ddu page
Mutation
origin
Strain of Origin:  C57BL/6 x CBA
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsUsing an sgRNA (targeting ACAGCGCCTCCTCCTGGACA) with CRISPR/Cas9 technology, a 7 bp deletion (GAGGAGG) was created in this Hoxd CTCF binding site region. (J:319862)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr44608 Mutation:  0 strains or lines available
References
Original:  J:319862 Amandio AR, et al., Sequential in cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse HoxD cluster. Genes Dev. 2021 Nov 1;35(21-22):1490-1509
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory