About   Help   FAQ
Epha1em1Aduci
Endonuclease-mediated Allele Detail
Summary
Symbol: Epha1em1Aduci
Name: Eph receptor A1; endonuclease-mediated mutation 1, Frank LaFerla
MGI ID: MGI:7327103
Synonyms: Epha1-P461L
Gene: Epha1  Location: Chr6:42335421-42350202 bp, - strand  Genetic Position: Chr6, 20.65 cM
Alliance: Epha1em1Aduci page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGuide RNAs (AGCTGGTGAAGAAAGAACCG and CAAGTCAGCTCCAGCTGCCT) are designed to create a CCG to TTG missense mutation resulting in a proline to leucine mutation (P461L) orthologous to the location of human SNP rs202178565 in the Eph receptor A1 (Epha1) gene. Human SNP rs202178565 has been found in human EPHA1 and is associated with increased risk of sporadic Alzheimer's disease (AD). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Epha1 Mutation:  48 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory