About   Help   FAQ
Gng12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gng12em1(IMPC)J
Name: guanine nucleotide binding protein (G protein), gamma 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7327089
Gene: Gng12  Location: Chr6:66873381-66998334 bp, + strand  Genetic Position: Chr6, 30.68 cM
Alliance: Gng12em1(IMPC)J page
IMPC: Gng12 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCGTCACCAAAATTACTGCA and CCTTCCTCACGCCATCCCTA, which resulted in a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256838 and ENSMUSE00000698574 (exons 3,4) and 4115 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. There is a 2 bp (CT) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gng12 Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory