Fam163b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam163b^em1(IMPC)J
• Name: family with sequence similarity 163, member B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7327066
• Gene: Fam163b Location: Chr2:27000391-27032489 bp, - strand Genetic Position: Chr2, 19.25 cM
• Alliance: Fam163b^em1(IMPC)J page
• IMPC: Fam163b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGCCTGAAGGTGCCCAG and TCTCTACAAGACCATCAAGA, which resulted in a 3410 bp deletion beginning at Chromosome 2 position 27,110,337 bp and ending after 27,113,746 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851960 and ENSMUSE00000737448 (exons 2 and 3) and 783 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam163b Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)