Nfam1^em1Juk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nfam1^em1Juk
• Name: Nfat activating molecule with ITAM motif 1; endonuclease-mediated mutation 1, Kathryn W Juchem
• MGI ID: MGI:7316684
• Gene: Nfam1 Location: Chr15:82880937-82917598 bp, - strand Genetic Position: Chr15, 39.01 cM, cytoband E2
• Alliance: Nfam1^em1Juk page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR.cas9 mediated recombination using 2 guide RNAs (proximal: TAATTGTTCGGCCGGACGC and distal: AGGGCAGCTACTCTCCCGAG) created a deletion that removed exons 2 and 3. (J:326682)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nfam1 Mutation: 15 strains or lines available

References

• Original: J:326682 Juchem KW, et al., NFAM1 Promotes Pro-Inflammatory Cytokine Production in Mouse and Human Monocytes. Front Immunol. 2021;12:773445
• All: 1 reference(s)