Tg(Rr29*-lacZ)HxcTshir
Transgene Detail
|
|
| Symbol: |
Tg(Rr29*-lacZ)HxcTshir |
| Name: |
transgene insertion Hxc, Toshihiko Shiroishi |
| MGI ID: |
MGI:7316656 |
| Synonyms: |
6xHx-ctrl |
| Transgene: |
Tg(Rr29*-lacZ)HxcTshir Location: unknown
|
| Alliance: |
Tg(Rr29*-lacZ)HxcTshir page
|
|
| Strain of Origin: |
(C57BL/6 x DBA/1)F1
|
|
| Transgene Type: |
|
Transgenic (Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: A total of six copies of a 40 bp sequence around the wildtype sequence of the Rr29Hx mutation (TTTCCAACAATTTATGGATCATCAGTGGCAAAAAAAACAA) of the mouse MFCS1 (Rr29) SSh enhancer were placed up- and downstream of an hsp68 promoter and lacZ beta-galactosidase reporter gene cassette.
(J:320682)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
|
| Original: |
J:320682 Amano T, et al., Two Types of Etiological Mutation in the Limb-Specific Enhancer of Shh. G3 (Bethesda). 2017 Sep 7;7(9):2991-2998 |
| All: |
1 reference(s) |
|
Analysis Tools
