Ankrd26^em1Ahol
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd26^em1Ahol
• Name: ankyrin repeat domain 26; endonuclease-mediated mutation 1, Andrew Holland
• MGI ID: MGI:7316648
• Gene: Ankrd26 Location: Chr6:118478269-118539187 bp, - strand Genetic Position: Chr6, 55.86 cM, cytoband F1
• Alliance: Ankrd26^em1Ahol page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing uses two guide RNAs (gccacacatccagggtcgag and gaaagctgtggtattcacgc) and a single-stranded DNA to delete exons 23-30. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ankrd26 Mutation: 69 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)