About   Help   FAQ
Fxnem10Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Fxnem10Lutzy
Name: frataxin; endonuclease-mediated mutation 10, Cathy Lutz
MGI ID: MGI:7316637
Synonyms: Fxnem10(T146T,I151F), FXNI151F
Gene: Fxn  Location: Chr19:24238817-24257969 bp, - strand  Genetic Position: Chr19, 19.39 cM, cytoband C1
Alliance: Fxnem10Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing using guide RNAs [AGACCCCAAACAAGCAAATC; ACAGCCAGATTTGCTTGTTT; and CAGCCAGATTTGCTTGTTTG] selected to target exon 4. Donor DNAs were created encoding an I151F point mutation (ATC to TTC) and a T146T silent mutation (ACC to ACT), which was introduced to destroy the PAM recognition site. Fxn transcript Fxn-201 is used as reference for the exon numbering and the guide/donor sequences. The I151F point mutation corresponds to the human I154F mutation associated with Friedreich's Ataxia. (J:326677)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fxn Mutation:  42 strains or lines available
References
Original:  J:326677 Medina-Carbonero M, et al., Mice harboring the FXN I151F pathological point mutation present decreased frataxin levels, a Friedreich ataxia-like phenotype, and mitochondrial alterations. Cell Mol Life Sci. 2022 Jan 17;79(2):74
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory