Fxn^em10Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fxn^em10Lutzy
• Name: frataxin; endonuclease-mediated mutation 10, Cathy Lutz
• MGI ID: MGI:7316637
• Synonyms: Fxn^{em10(T146T,I151F)}, FXN^I151F
• Gene: Fxn Location: Chr19:24238817-24257969 bp, - strand Genetic Position: Chr19, 19.39 cM, cytoband C1
• Alliance: Fxn^em10Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing using guide RNAs [AGACCCCAAACAAGCAAATC; ACAGCCAGATTTGCTTGTTT; and CAGCCAGATTTGCTTGTTTG] selected to target exon 4. Donor DNAs were created encoding an I151F point mutation (ATC to TTC) and a T146T silent mutation (ACC to ACT), which was introduced to destroy the PAM recognition site. Fxn transcript Fxn-201 is used as reference for the exon numbering and the guide/donor sequences. The I151F point mutation corresponds to the human I154F mutation associated with Friedreich's Ataxia. (J:326677)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fxn Mutation: 41 strains or lines available

References

• Original: J:326677 Medina-Carbonero M, et al., Mice harboring the FXN I151F pathological point mutation present decreased frataxin levels, a Friedreich ataxia-like phenotype, and mitochondrial alterations. Cell Mol Life Sci. 2022 Jan 17;79(2):74
• All: 1 reference(s)