Mecp2^em1Grib
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mecp2^em1Grib
• Name: methyl CpG binding protein 2; endonuclease-mediated mutation 1, Joost Gribnau
• MGI ID: MGI:7314169
• Synonyms: Mecp2^NLucTom
• Gene: Mecp2 Location: ChrX:73070198-73129296 bp, - strand Genetic Position: ChrX, 37.63 cM
• Alliance: Mecp2^em1Grib page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutations: Insertion, Intragenic deletion
• Mutation details: A guide RNA (TTAGCTGACTTTACATAGAG) is designed to fuse the NanoLuciferase-P2A-TdTomato (NLucTom) construct with the C-terminus, immediately before the stop codon, of the gene. Because of this guide RNA, 18bp of the 3'UTR directly downstream of the STOP codon has been deleted. Specifically, the construct contained (from 5' to 3') NLuc, a P2A ribosomal skip cleavage peptide sequence, and a constitutively fluorescent monoclonal orange fluorescent protein (tdTomato) reporter sequence. (J:326514)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mecp2 Mutation: 46 strains or lines available

References

• Original: J:326514 Mira-Bontenbal H, et al., Genetic and epigenetic determinants of reactivation of Mecp2 and the inactive X chromosome in neural stem cells. Stem Cell Reports. 2022 Mar 8;17(3):693-706
• All: 1 reference(s)