About   Help   FAQ
Mecp2em1Grib
Endonuclease-mediated Allele Detail
Summary
Symbol: Mecp2em1Grib
Name: methyl CpG binding protein 2; endonuclease-mediated mutation 1, Joost Gribnau
MGI ID: MGI:7314169
Synonyms: Mecp2NLucTom
Gene: Mecp2  Location: ChrX:73070198-73129296 bp, - strand  Genetic Position: ChrX, 37.63 cM
Alliance: Mecp2em1Grib page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsA guide RNA (TTAGCTGACTTTACATAGAG) is designed to fuse the NanoLuciferase-P2A-TdTomato (NLucTom) construct with the C-terminus, immediately before the stop codon, of the gene. Because of this guide RNA, 18bp of the 3'UTR directly downstream of the STOP codon has been deleted. Specifically, the construct contained (from 5' to 3') NLuc, a P2A ribosomal skip cleavage peptide sequence, and a constitutively fluorescent monoclonal orange fluorescent protein (tdTomato) reporter sequence. (J:326514)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mecp2 Mutation:  46 strains or lines available
References
Original:  J:326514 Mira-Bontenbal H, et al., Genetic and epigenetic determinants of reactivation of Mecp2 and the inactive X chromosome in neural stem cells. Stem Cell Reports. 2022 Mar 8;17(3):693-706
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory